Pay in installments of $85.00 with
,
and
Shipping Estimate
USA
- USA
- CAN
- USA
- CAN
Ships within 48 hours · Estimated delivery Aug 28 - Sep 2
Promo Codes Available:
For Your Every Summer RSVP, with Code: SUMMER15
Description
S. pyogenes Cas9 NLSProduct Specification Amino Acid Sequence
Product Specification
| Amino Acid Sequence |
APKKKRKVGIHGVPAADKKYSIGLDIGTNSVGWAVITDEYKVPSKKFKVLGNTDRHSIKKNLIGALLFDSGETAEATRLKRTARRRYTRRKNRICYLQEIFSNEMAKVDDSFFHRLEESFLVEEDKKHERHPIFGNIVDEVAYHEKYPTIYHLRKKLVDSTDKADLRLIYLALAHMIKFRGHFLIEGDLNPDNSDVDKLFIQLVQTYNQLFEENPINASGVDAKAILSARLSKSRRLENLIAQLPGEKKNGLFGNLIALSLGLTPNFKSNFDLAEDAKLQLSKDTYDDDLDNLLAQIGDQYADLFLAAKNLSDAILLSDILRVNTEITKAPLSASMIKRYDEHHQDLTLLKALVRQQLPEKYKEIFFDQSKNGYAGYIDGGASQEEFYKFIKPILEKMDGTEELLVKLNREDLLRKQRTFDNGSIPHQIHLGELHAILRRQEDFYPFLKDNREKIEKILTFRIPYYVGPLARGNSRFAWMTRKSEETITPWNFEEVVDKGASAQSFIERMTNFDKNLPNEKVLPKHSLLYEYFTVYNELTKVKYVTEGMRKPAFLSGEQKKAIVDLLFKTNRKVTVKQLKEDYFKKIECFDSVEISGVEDRFNASLGTYHDLLKIIKDKDFLDNEENEDILEDIVLTLTLFEDREMIEERLKTYAHLFDDKVMKQLKRRRYTGWGRLSRKLINGIRDKQSGKTILDFLKSDGFANRNFMQLIHDDSLTFKEDIQKAQVSGQGDSLHEHIANLAGSPAIKKGILQTVKVVDELVKVMGRHKPENIVIEMARENQTTQKGQKNSRERMKRIEEGIKELGSQILKEHPVENTQLQNEKLYLYYLQNGRDMYVDQELDINRLSDYDVDHIVPQSFLKDDSIDNKVLTRSDKNRGKSDNVPSEEVVKKMKNYWRQLLNAKLITQRKFDNLTKAERGGLSELDKAGFIKRQLVETRQITKHVAQILDSRMNTKYDENDKLIREVKVITLKSKLVSDFRKDFQFYKVREINNYHHAHDAYLNAVVGTALIKKYPKLESEFVYGDYKVYDVRKMIAKSEQEIGKATAKYFFYSNIMNFFKTEITLANGEIRKRPLIETNGETGEIVWDKGRDFATVRKVLSMPQVNIVKKTEVQTGGFSKESILPKRNSDKLIARKKDWDPKKYGGFDSPTVAYSVLVVAKVEKGKSKKLKSVKELLGITIMERSSFEKNPIDFLEAKGYKEVKKDLIIKLPKYSLFELENGRKRMLASAGELQKGNELALPSKYVNFLYLASHYEKLKGSPEDNEQKQLFVEQHKHYLDEIIEQISEFSKRVILADANLDKVLSAYNKHRDKPIREQAENIIHLFTLTNLGAPAAFKYFDTTIDRKRYTSTKEVLDATLIHQSITGLYETRIDLSQLGGDKRPAATKKAGQAKKKK
|
| Expression System | E.coli |
| Molecular Weight |
The recombinant SpCas9 NLS consists of 1399 amino acids and has a predicted molecular
mass of 161.7 kDa. |
| Purity | ≥ 97% by SDS-PAGE gel analyses. |
| Endotoxin | <0.1EU/μg |
| Tag | No Tag |
| Physical Appearance | Liquid |
| Storage Buffer |
10 mM Tris-HCl pH 7.5, 300 mM NaCl, 0.1 mM EDTA, 1.0 mM TCEP, 50% glycerol.
|
| Stability & Storage |
Please use a manual defrost freezer and avoid repeated freeze-thaw cycles. 24 months from date of receipt, -20 to -70 °C as supplied. 12 months, -20 to -70 °C under sterile conditions after opening. |
Protocol
Activity Assay Protocol
Materials
Assay Buffer: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 µg/mL BSA, pH 7.9
Recombinant S. pyogenes Cas9 NLS
DNA Substrate: PBR322 vector digested with EcoRI Synthetic sgRNA, targeting sequence:, targeting sequence: GAGGCAGACAAGGTATAGGG
Ethidium Bromide, 10 mg/mL
Ultrapure DNase/RNase-Free Distilled Water, to prepare Assay Buffer
Assay
1. Prepare RNP Complex:
a. 600 nM sgRNA (6 µL addition from 3 µM stock prepared in Assay Buffer)
b. 0.25μg rSpCas9 NLS
c. Add Assay Buffer for a final RNP Complex volume of 26.5 µL
d. Incubate for 5 minutes at 37 °C.
2. Mix RNP Complex with 3.5 μL of 8.6 ng/µL of DNA Substrate (diluted in Assay Buffer, if possible).
3. Incubate for 1 hour at 37 °C.
4. Incubate for 10 minutes at 65 °C to dissociate enzyme from DNA.
5. Load total reaction with loading dye on a 1% agarose gel.
6. Run gel at 140 V for 40 minutes.
7. Soak gel in 200 mL TAE with 150 μL of 10 mg/mL ethidium bromide for 1 hour.
8. Use imaging software to detect and quantify hydrolysis of the DNA substrate.
Shipping Notes
- Free Standard Shipping on $100+ Orders to the USA.
- Except Preorder products are shipped in 48 hours.
- Delivery to the USA:
- Standard Shipping : 3-10 business days
- If time is of the essence, please consider selecting expedited delivery for faster service.
Exchange/Return Notes
- We offer a 30-day return/exchange service after receiving.
- Final sale items are not eligible for returns or exchanges.
- To process your return/exchange, please contact us at [email protected]
- Please click here for more details>>> Return & Exchange Policy