S. pyogenes Cas9 NLS
SKU: 45637918893

S. pyogenes Cas9 NLS

Sale price$306.00 Regular price$340.00
Save 10%

Shipping Estimate
USA
  • USA
  • CAN

Ships within 48 hours · Estimated delivery Jul 9 - Jul 14

Promo Codes Available:

For Your Every Summer RSVP, with Code: SUMMER15

Description

S. pyogenes Cas9 NLSProduct Specification Amino Acid Sequence

Product Specification


Amino Acid Sequence

APKKKRKVGIHGVPAADKKYSIGLDIGTNSVGWAVITDEYKVPSKKFKVLGNTDRHSIKKNLIGALLFDSGETAEATRLKRTARRRYTRRKNRICYLQEIFSNEMAKVDDSFFHRLEESFLVEEDKKHERHPIFGNIVDEVAYHEKYPTIYHLRKKLVDSTDKADLRLIYLALAHMIKFRGHFLIEGDLNPDNSDVDKLFIQLVQTYNQLFEENPINASGVDAKAILSARLSKSRRLENLIAQLPGEKKNGLFGNLIALSLGLTPNFKSNFDLAEDAKLQLSKDTYDDDLDNLLAQIGDQYADLFLAAKNLSDAILLSDILRVNTEITKAPLSASMIKRYDEHHQDLTLLKALVRQQLPEKYKEIFFDQSKNGYAGYIDGGASQEEFYKFIKPILEKMDGTEELLVKLNREDLLRKQRTFDNGSIPHQIHLGELHAILRRQEDFYPFLKDNREKIEKILTFRIPYYVGPLARGNSRFAWMTRKSEETITPWNFEEVVDKGASAQSFIERMTNFDKNLPNEKVLPKHSLLYEYFTVYNELTKVKYVTEGMRKPAFLSGEQKKAIVDLLFKTNRKVTVKQLKEDYFKKIECFDSVEISGVEDRFNASLGTYHDLLKIIKDKDFLDNEENEDILEDIVLTLTLFEDREMIEERLKTYAHLFDDKVMKQLKRRRYTGWGRLSRKLINGIRDKQSGKTILDFLKSDGFANRNFMQLIHDDSLTFKEDIQKAQVSGQGDSLHEHIANLAGSPAIKKGILQTVKVVDELVKVMGRHKPENIVIEMARENQTTQKGQKNSRERMKRIEEGIKELGSQILKEHPVENTQLQNEKLYLYYLQNGRDMYVDQELDINRLSDYDVDHIVPQSFLKDDSIDNKVLTRSDKNRGKSDNVPSEEVVKKMKNYWRQLLNAKLITQRKFDNLTKAERGGLSELDKAGFIKRQLVETRQITKHVAQILDSRMNTKYDENDKLIREVKVITLKSKLVSDFRKDFQFYKVREINNYHHAHDAYLNAVVGTALIKKYPKLESEFVYGDYKVYDVRKMIAKSEQEIGKATAKYFFYSNIMNFFKTEITLANGEIRKRPLIETNGETGEIVWDKGRDFATVRKVLSMPQVNIVKKTEVQTGGFSKESILPKRNSDKLIARKKDWDPKKYGGFDSPTVAYSVLVVAKVEKGKSKKLKSVKELLGITIMERSSFEKNPIDFLEAKGYKEVKKDLIIKLPKYSLFELENGRKRMLASAGELQKGNELALPSKYVNFLYLASHYEKLKGSPEDNEQKQLFVEQHKHYLDEIIEQISEFSKRVILADANLDKVLSAYNKHRDKPIREQAENIIHLFTLTNLGAPAAFKYFDTTIDRKRYTSTKEVLDATLIHQSITGLYETRIDLSQLGGDKRPAATKKAGQAKKKK

Expression System E.coli
Molecular Weight

The recombinant SpCas9 NLS consists of 1399 amino acids and has a predicted molecular mass of 161.7 kDa.

Purity ≥ 97% by SDS-PAGE gel analyses.
Endotoxin <0.1EU/μg
Tag No Tag
Physical Appearance Liquid
Storage Buffer

10 mM Tris-HCl pH 7.5, 300 mM NaCl, 0.1 mM EDTA, 1.0 mM TCEP, 50% glycerol.

Stability & Storage

Please use a manual defrost freezer and avoid repeated freeze-thaw cycles.

24 months from date of receipt, -20 to -70 °C as supplied.

12 months, -20 to -70 °C under sterile conditions after opening.

Protocol

Activity Assay Protocol

Materials

Assay Buffer: 50 mM NaCl, 10 mM Tris-HCl, 10 mM MgCl2, 100 µg/mL BSA, pH 7.9

Recombinant S. pyogenes Cas9 NLS

DNA Substrate: PBR322 vector digested with EcoRI Synthetic sgRNA, targeting sequence:, targeting sequence: GAGGCAGACAAGGTATAGGG

Ethidium Bromide, 10 mg/mL

Ultrapure DNase/RNase-Free Distilled Water, to prepare Assay Buffer

Assay

1. Prepare RNP Complex:

a. 600 nM sgRNA (6 µL addition from 3 µM stock prepared in Assay Buffer)

b. 0.25μg rSpCas9 NLS

c. Add Assay Buffer for a final RNP Complex volume of 26.5 µL

d. Incubate for 5 minutes at 37 °C.

2. Mix RNP Complex with 3.5 μL of 8.6 ng/µL of DNA Substrate (diluted in Assay Buffer, if possible).

3. Incubate for 1 hour at 37 °C.

4. Incubate for 10 minutes at 65 °C to dissociate enzyme from DNA.

5. Load total reaction with loading dye on a 1% agarose gel.

6. Run gel at 140 V for 40 minutes.

7. Soak gel in 200 mL TAE with 150 μL of 10 mg/mL ethidium bromide for 1 hour.

8. Use imaging software to detect and quantify hydrolysis of the DNA substrate.

Shipping Notes
  • Free Standard Shipping on $100+ Orders to the USA.
  • Except Preorder products are shipped in 48 hours.
  • Delivery to the USA:
  1. Standard Shipping : 3-10 business days
  • If time is of the essence, please consider selecting expedited delivery for faster service.
Exchange/Return Notes
  • We offer a 30-day return/exchange service after receiving.
  • Final sale items are not eligible for returns or exchanges.
  • To process your return/exchange, please contact us at [email protected]
  • Please click here for more details>>> Return & Exchange Policy
SKU: 45637918893

Discover Niche Categories That Outsell

Top-Converting Item to Boost Your Average Order

4.7 ★★★★★
Based on 1219 reviews
Sort
Highest Rating
Newest First
Oldest First
Product Reviews
R
Rob Kujovich
Natrona Heights, US
★★★★★ 4
The toys body is very durable, but the squeakers were broken within minutes without tearing it apart
Color: Green Bird
This is a squeaky dog toy that was supposedly very durable. I have to say that the squeakers are not durable and were immediately destroyed by my husky. The actual body of the toy is very durable and they were not able to rip it apart. They were able to destroy the squeakers without damaging the actual exterior of this toy. The toy itself is pretty soft except where it’s made of rope. Since it didn’t have any stuffing come out I will say that it was durable enough for chewing. This would be suitable for large larger dogs and even smaller dogs. I do feel this is a good value for the money because they were not able to rip it apart. I just wish the squeakers were more durable inside because there’s no way to replace those.
WAS THIS REVIEW HELPFUL?YesReportShare
Reviewed in the United States on June 4, 2026
D
Darin Kelly
Omaha, US
★★★★★ 5
Our dogs new favorite toy
Color: Green Bird, Color: Green Bird
Our golden doodle loves this toy. He isn't a highly aggressive chewer necessarily, but he has been known to destroy toys by chewing on them and such. This one, so far, has lasted over a month or so. It has turned out to be his go to toy when he's wanting to play with one. The squeaker isn't that loud and it's not that easy to find. I like that legs are rope material and makes it good for tug of war, which Max loves to do. The material is pretty sturdy and it is a good weight. Sometimes when the toys are too heavy Max won't catch them in the air, this one he catches in the air just fine. It's very cute and I think it will hold up just fine to our Max's level of chewing. I felt the price was quite reasonable considering how much he likes it.
WAS THIS REVIEW HELPFUL?YesReportShare
Reviewed in the United States on May 2, 2026
L
Verified Purchase
Lapayswa Nimmons
West Palm Beach, US
★★★★★ 2
My dog destroyed this toy in 72 hours
Color: Blue Bird, Color: Blue Bird
Loved the toy but unfortunately this indestructible toy was destroyed by my Yorkie puppy in 3 days
WAS THIS REVIEW HELPFUL?YesReportShare
Reviewed in the United States on April 6, 2026
M
Micah
Omaha, US
★★★★★ 5
Fun squeaky toy that my dogs destroyed quickly
Color: Green Bird
My dogs were immediately obsessed with this toy. The squeaker and bright bird shape got their attention right away, and they carried it around the house constantly for the first couple of days. The rope running through the middle also made it more fun for tug games. The plush material is soft enough for carrying and cuddling, but because of that, it definitely was not long lasting with stronger chewers. Mine managed to tear into it fairly quickly despite really enjoying it. That said, it kept them entertained the entire time it survived, and the squeaker held up longer than I expected. I would recommend this more as a supervised play toy or fetch/tug toy rather than something for aggressive chewing sessions. If your dog loves squeaky plush toys, this one is very fun while it lasts.
WAS THIS REVIEW HELPFUL?YesReportShare
Reviewed in the United States on May 29, 2026
M
Verified Purchase
Mikelford
Dallas, US
★★★★★ 4
Dog Loves it
Color: Gray Bird
Great Toy for the price
WAS THIS REVIEW HELPFUL?YesReportShare
Reviewed in the United States on June 2, 2026

recommand products